| Worm gene name: | col-104 |
| Worm sequence name: | F58F6.1 |
| Related human gene: | col17a1 |
| Associated human disease: | Epidermolysis Bullosa |
| People involved in this project: |
|
| Left primer sequence: | gatcgccttctccctatcct |
| Right primer sequence: | gggcgagttgtctgtctctt |
| Size of PCR product: | 207 |
| Brief description: | Genetic disorder affecting collagen. In humans Epidermolysis Bullosa results in severe blistering. |
| Report any problems that might have appeared and any solutions: | Phenotypic changes observed included lighter pigmentation compared to wild type, a small yield of progeny, and 2 to 3 worms which displayed a cuticle blister.
A problem arose with the primer, in that, the DNA plasmid insert was of an unexpected size. However, since phenotypic change did result, it can be concluded that the primers did work. |
| Media attachments: |
|
