Home | Projects | Login or register:
Username:   Password:

Worm gene name:  sqv-7
Worm sequence name:  C52E12.3
Related human gene: 
Associated human disease:  Skeletal Dysplasia
People involved in this project: 
Left primer sequence:  actacaacctgcgttggtcc
Right primer sequence:  gtaaagcaattaacgggggc
Size of PCR product:  520
Brief description:  Squashed vulva
Report any problems that might have appeared and any solutions: 
View(1) or add comments