Worm gene name: | sqv-7 |
Worm sequence name: | C52E12.3 |
Related human gene: | |
Associated human disease: | Skeletal Dysplasia |
People involved in this project: |
|
Left primer sequence: | actacaacctgcgttggtcc |
Right primer sequence: | gtaaagcaattaacgggggc |
Size of PCR product: | 520 |
Brief description: | Squashed vulva |
Report any problems that might have appeared and any solutions: | |
Based on PCR and Gel Electrophoresis expected product of 520 bp was observed. Through creation of an sqv-7 RNAi feeding strain phenotypes of progeny appeared to be more bloated and a decreased brood size.