| Worm gene name: | sec-23 |
| Worm sequence name: | Y113G7A.3 |
| Related human gene: | SEC23A |
| Associated human disease: | Craniolenticulosutral Dysplasia |
| People involved in this project: |
|
| Left primer sequence: | gaaacaccgaaggcatgaat |
| Right primer sequence: | tttcagcgatttcagctcct |
| Size of PCR product: | 899 |
| Brief description: | This gene when repressed by RNAi causes maternal sterility, embryonic lethality, abnormal protein subcellular localization, molting defects, and reduced brood size. These result from the lack of formation of the sec-23 subunit on the Cop II protein that is used to make a vesicle coat for proteins leaving the endoplasmic reticulum and moving to the Golgi complex.
In humans this cause facial and skeletal deformities. |
| Report any problems that might have appeared and any solutions: | We had difficulty observing a phenotypic expression of the repression of our gene. We went back and did a mini prep using our HT115(DE3) transformant. After PCR for T7 promoter and the insert and running the PCR product on a gel, it was observed that the insertion was unsuccessful. We had successful transformation with a plasmid because we had amp resistance but our vector did not have the insert. |
| Media attachments: |
|
