Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Igc-37
Worm sequence name:  ZC482.5
Related human gene:  gamma-aminobutyric acid (GABA) A receptor, alpha 5 precursor
Associated human disease:  Autism
People involved in this project: 
Left primer sequence:  cagccgaagcacaacttaca
Right primer sequence:  gaacctgaccatctgaccgt
Size of PCR product:  392
Brief description:  ZC482.5 is orthologous to the human gene GAMMA-AMINOBUTYRIC ACID A RECEPTOR GAMMA 2 (GABRG2; OMIM:137164), which when mutated leads to disease.
Report any problems that might have appeared and any solutions: 
View(0) or add comments