| Worm gene name: | Igc-37 |
| Worm sequence name: | ZC482.5 |
| Related human gene: | gamma-aminobutyric acid (GABA) A receptor, alpha 5 precursor |
| Associated human disease: | Autism |
| People involved in this project: |
|
| Left primer sequence: | cagccgaagcacaacttaca |
| Right primer sequence: | gaacctgaccatctgaccgt |
| Size of PCR product: | 392 |
| Brief description: | ZC482.5 is orthologous to the human gene GAMMA-AMINOBUTYRIC ACID A RECEPTOR GAMMA 2 (GABRG2; OMIM:137164), which when mutated leads to disease. |
| Report any problems that might have appeared and any solutions: | |
