Worm gene name: | Multiple drug resistance protein family (mrp-1) |
Worm sequence name: | F57C12.5a |
Related human gene: | cystic fibrosis transmembrane conductance regulator |
Associated human disease: | Cystic Fibrosis |
People involved in this project: |
|
Left primer sequence: | aacgaaagagacaaagccga |
Right primer sequence: | gctagtacggagacgccaag |
Size of PCR product: | 593 |
Brief description: | In volve in multiple drug resistance in C.elegans. |
Report any problems that might have appeared and any solutions: | |