| Worm gene name: | Multiple drug resistance protein family (mrp-1) |
| Worm sequence name: | F57C12.5a |
| Related human gene: | cystic fibrosis transmembrane conductance regulator |
| Associated human disease: | Cystic Fibrosis |
| People involved in this project: |
|
| Left primer sequence: | aacgaaagagacaaagccga |
| Right primer sequence: | gctagtacggagacgccaag |
| Size of PCR product: | 593 |
| Brief description: | In volve in multiple drug resistance in C.elegans. |
| Report any problems that might have appeared and any solutions: | |
