Worm gene name:  Multiple drug resistance protein family (mrp-1)
Worm sequence name:  F57C12.5a
Related human gene:  cystic fibrosis transmembrane conductance regulator
Associated human disease:  Cystic Fibrosis
People involved in this project: 
Left primer sequence:  aacgaaagagacaaagccga
Right primer sequence:  gctagtacggagacgccaag
Size of PCR product:  593
Brief description:  In volve in multiple drug resistance in C.elegans.
Report any problems that might have appeared and any solutions: