Worm gene name:  cep-1
Worm sequence name:  F52B5.5a
Related human gene:  p-53
Associated human disease:  Cancer
People involved in this project: 
Left primer sequence:  gtgttgttcaatgcaaacgg
Right primer sequence:  aacatcattcgtagccggac
Size of PCR product:  362
Brief description:  This gene regulates apoptosis in cells.
Report any problems that might have appeared and any solutions:  none
View(0) or add comments