| Worm gene name: | cep-1 |
| Worm sequence name: | F52B5.5a |
| Related human gene: | p-53 |
| Associated human disease: | Cancer |
| People involved in this project: |
|
| Left primer sequence: | gtgttgttcaatgcaaacgg |
| Right primer sequence: | aacatcattcgtagccggac |
| Size of PCR product: | 362 |
| Brief description: | This gene regulates apoptosis in cells. |
| Report any problems that might have appeared and any solutions: | none |
