Home | Projects | Login or register:
Username:   Password:

Worm gene name:  apr-1
Worm sequence name:  K04G2.8a
Related human gene:  APC Beta-catenin binding protein
Associated human disease:  familial adenomatous polyposis
People involved in this project: 
Left primer sequence:  tcttcctgcgtcaaactgtg
Right primer sequence:  cagcaagattccacaaagca
Size of PCR product:  900
Brief description:  required for germline fertility,embyrogenesis, and vulva development
Report any problems that might have appeared and any solutions: 
View(0) or add comments