| Worm gene name: | apr-1 |
| Worm sequence name: | K04G2.8a |
| Related human gene: | APC Beta-catenin binding protein |
| Associated human disease: | familial adenomatous polyposis |
| People involved in this project: |
|
| Left primer sequence: | tcttcctgcgtcaaactgtg |
| Right primer sequence: | cagcaagattccacaaagca |
| Size of PCR product: | 900 |
| Brief description: | required for germline fertility,embyrogenesis, and vulva development |
| Report any problems that might have appeared and any solutions: | |
