Home | Projects | Login or register:
Username:   Password:

Worm gene name:  C53D5.5
Worm sequence name:  C53D5.5
Related human gene:  GGT-1
Associated human disease:  glutathionuria
People involved in this project: 
Left primer sequence:  ccttgcaaaagctctcaacc
Right primer sequence:  ggccaccaaaaatttccttt
Size of PCR product:  761
Brief description:  In humans the enzyme gamma-glutamyl transpeptidase is used in the catabolism of glutathione. It is found on the outer surface of the cell membrane. Can be an early sign of hepatocellular carcinoma.
Report any problems that might have appeared and any solutions:  phenotype observed in worms by 1 of 3 papers was a reduced brood size.
View(0) or add comments