| Worm gene name: | C53D5.5 |
| Worm sequence name: | C53D5.5 |
| Related human gene: | GGT-1 |
| Associated human disease: | glutathionuria |
| People involved in this project: |
|
| Left primer sequence: | ccttgcaaaagctctcaacc |
| Right primer sequence: | ggccaccaaaaatttccttt |
| Size of PCR product: | 761 |
| Brief description: | In humans the enzyme gamma-glutamyl transpeptidase is used in the catabolism of glutathione. It is found on the outer surface of the cell membrane. Can be an early sign of hepatocellular carcinoma. |
| Report any problems that might have appeared and any solutions: | phenotype observed in worms by 1 of 3 papers was a reduced brood size. |
