Worm gene name: | xpa-1 |
Worm sequence name: | K07G5.2 |
Related human gene: | Xeroderma Pigmentosum comp group A |
Associated human disease: | Xeroderma Pigmentosum |
People involved in this project: |
|
Left primer sequence: | aattttcaggcgaagaagca |
Right primer sequence: | ttcggaacgaacttctttgg |
Size of PCR product: | 474 |
Brief description: | There are 5 exons and 4 introns with a nonexpressed DNA section at the end. |
Report any problems that might have appeared and any solutions: | none |