| Worm gene name: | xpa-1 |
| Worm sequence name: | K07G5.2 |
| Related human gene: | Xeroderma Pigmentosum comp group A |
| Associated human disease: | Xeroderma Pigmentosum |
| People involved in this project: |
|
| Left primer sequence: | aattttcaggcgaagaagca |
| Right primer sequence: | ttcggaacgaacttctttgg |
| Size of PCR product: | 474 |
| Brief description: | There are 5 exons and 4 introns with a nonexpressed DNA section at the end. |
| Report any problems that might have appeared and any solutions: | none |
