Worm gene name: | alcohol dehydrogenase |
Worm sequence name: | H24K24.3 |
Related human gene: | alcohol dehydrogenase |
Associated human disease: | |
People involved in this project: |
|
Left primer sequence: | attgagacgatccaagtggc |
Right primer sequence: | taaatccatttccctgcgag |
Size of PCR product: | 304 |
Brief description: | ALCOHOL DEHYDROGENASE 1B (ADH1B) is responsible for most of the activity in the adult liver. |
Report any problems that might have appeared and any solutions: | |