Home | Projects | Login or register:
Username:   Password:

Worm gene name:  alcohol dehydrogenase
Worm sequence name:  H24K24.3
Related human gene:  alcohol dehydrogenase
Associated human disease: 
People involved in this project: 
Left primer sequence:  attgagacgatccaagtggc
Right primer sequence:  taaatccatttccctgcgag
Size of PCR product:  304
Brief description:  ALCOHOL DEHYDROGENASE 1B (ADH1B) is responsible for most of the activity in the adult liver.
Report any problems that might have appeared and any solutions: 
View(0) or add comments