| Worm gene name: | alcohol dehydrogenase |
| Worm sequence name: | H24K24.3 |
| Related human gene: | alcohol dehydrogenase |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | attgagacgatccaagtggc |
| Right primer sequence: | taaatccatttccctgcgag |
| Size of PCR product: | 304 |
| Brief description: | ALCOHOL DEHYDROGENASE 1B (ADH1B) is responsible for most of the activity in the adult liver. |
| Report any problems that might have appeared and any solutions: | |
