Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ace-1
Worm sequence name:  W09B12.1.1
Related human gene:  NLGN3 (Neuroligin-3)
Associated human disease:  Asperger's syndrome
People involved in this project: 
Left primer sequence:  gtacaagctcgcaatcgtca
Right primer sequence:  atcaaattcggcaaatacgc
Size of PCR product:  465
Brief description:  Asperger's syndrome is a mild variant of autism spectrum disorder. A number of possible gene candidates for familial forms of the disorder have been identified, including an X-linked gene (NLGN3) encoding neuroligin 3. The worm gene, ace-1 shares significant homology to the human gene.
Report any problems that might have appeared and any solutions: 
View(0) or add comments