| Worm gene name: | ace-1 |
| Worm sequence name: | W09B12.1.1 |
| Related human gene: | NLGN3 (Neuroligin-3) |
| Associated human disease: | Asperger's syndrome |
| People involved in this project: |
|
| Left primer sequence: | gtacaagctcgcaatcgtca |
| Right primer sequence: | atcaaattcggcaaatacgc |
| Size of PCR product: | 465 |
| Brief description: | Asperger's syndrome is a mild variant of autism spectrum disorder. A number of possible gene candidates for familial forms of the disorder have been identified, including an X-linked gene (NLGN3) encoding neuroligin 3. The worm gene, ace-1 shares significant homology to the human gene. |
| Report any problems that might have appeared and any solutions: | |
