Home | Projects | Login or register:
Username:   Password:

Worm gene name:  smf-3
Worm sequence name:  Y69A2AR.4
Related human gene:  NRAMP1
Associated human disease:  Natural resistance, Mycobacteria, Salmonella, and Leishmania
People involved in this project: 
Left primer sequence:  ggagtgcgaaagtttgaagc
Right primer sequence:  cttgccgcctctaactcaac
Size of PCR product:  398
Brief description:  Score = 535 bits (1377), Expect = 2e-151,
Identities = 286/553 (51%), Positives = 371/553 (67%), Gaps = 24/553 (4%)
Report any problems that might have appeared and any solutions:  another primer:
ggagtgcgaaagtttgaagc ttgccgcctctaactcaact
View(0) or add comments