| Worm gene name: | smf-3 |
| Worm sequence name: | Y69A2AR.4 |
| Related human gene: | NRAMP1 |
| Associated human disease: | Natural resistance, Mycobacteria, Salmonella, and Leishmania |
| People involved in this project: |
|
| Left primer sequence: | ggagtgcgaaagtttgaagc |
| Right primer sequence: | cttgccgcctctaactcaac |
| Size of PCR product: | 398 |
| Brief description: | Score = 535 bits (1377), Expect = 2e-151,
Identities = 286/553 (51%), Positives = 371/553 (67%), Gaps = 24/553 (4%) |
| Report any problems that might have appeared and any solutions: | another primer:
ggagtgcgaaagtttgaagc ttgccgcctctaactcaact |
