Home | Projects | Login or register:
Username:   Password:

Worm gene name:  sli-1
Worm sequence name:  M02A10.3
Related human gene:  CBL
Associated human disease:  Breast Cancer
People involved in this project: 
Left primer sequence:  cccggatactgtgcatttct
Right primer sequence:  tccgtaaaatctgggacagc
Size of PCR product:  440
Brief description:  C. elegans has one ErbB gene, called let-23, which controls the amount of vulval tissue in these animals. In an analogous manner to the situation in breast cancer, worms that have too much let-23 activity develop too much vulval tissue. This gives us a system and a phenotypic read-out to find other nematode genes that influence let-23. The sli-1 gene is a negative regulator of LET-23 and was shown by Yoon et al. (1995) to encode a protein similar to the mammalian protooncoprotein CBL2.
Report any problems that might have appeared and any solutions: 
View(0) or add comments