| Worm gene name: | sli-1 |
| Worm sequence name: | M02A10.3 |
| Related human gene: | CBL |
| Associated human disease: | Breast Cancer |
| People involved in this project: |
|
| Left primer sequence: | cccggatactgtgcatttct |
| Right primer sequence: | tccgtaaaatctgggacagc |
| Size of PCR product: | 440 |
| Brief description: | C. elegans has one ErbB gene, called let-23, which controls the amount of vulval tissue in these animals. In an analogous manner to the situation in breast cancer, worms that have too much let-23 activity develop too much vulval tissue. This gives us a system and a phenotypic read-out to find other nematode genes that influence let-23. The sli-1 gene is a negative regulator of LET-23 and was shown by Yoon et al. (1995) to encode a protein similar to the mammalian protooncoprotein CBL2. |
| Report any problems that might have appeared and any solutions: | |
