Home | Projects | Login or register:
Username:   Password:

Worm gene name:  H37A05.1
Worm sequence name:  H37A05.1
Related human gene:  LPIN-2
Associated human disease:  Human - LPIN2 Chronic recurrent multifocal osteomyelitis, congenital dyserythropoietic anemia, and neutrophilic dermatosis
People involved in this project: 
Left primer sequence:  tcaacaccattccatgttcg
Right primer sequence:  ttctccccatttccagtcag
Size of PCR product:  957
Brief description:  (OMIM:605518), LPIN2 (OMIM:605519, mutated in Majeed syndrome), and LPIN3 (OMIM:605520); H37A05.1 is expressed in vulval muscle; in mass RNAi assays, H37A05.1 is required for the osmotic integrity of eggs and for normal larval growth, body thickness, locomotion, and fertility; by orthology, H37A05.1 is expected to be dephosphorylated by SCPL-2. [details
Report any problems that might have appeared and any solutions:  experiment still in progress
View(0) or add comments