| Worm gene name: | H37A05.1 |
| Worm sequence name: | H37A05.1 |
| Related human gene: | LPIN-2 |
| Associated human disease: | Human - LPIN2 Chronic recurrent multifocal osteomyelitis, congenital dyserythropoietic anemia, and neutrophilic dermatosis |
| People involved in this project: |
|
| Left primer sequence: | tcaacaccattccatgttcg |
| Right primer sequence: | ttctccccatttccagtcag |
| Size of PCR product: | 957 |
| Brief description: | (OMIM:605518), LPIN2 (OMIM:605519, mutated in Majeed syndrome), and LPIN3 (OMIM:605520); H37A05.1 is expressed in vulval muscle; in mass RNAi assays, H37A05.1 is required for the osmotic integrity of eggs and for normal larval growth, body thickness, locomotion, and fertility; by orthology, H37A05.1 is expected to be dephosphorylated by SCPL-2. [details |
| Report any problems that might have appeared and any solutions: | experiment still in progress |
