Home | Projects | Login or register:
Username:   Password:

Worm gene name:  rep-1
Worm sequence name:  Y67D2.1
Related human gene:  rep-1
Associated human disease:  Choroideremia
People involved in this project: 
Left primer sequence:  tagcaccgatttcagctgtg
Right primer sequence:  gtgaagcctcttccagttgc
Size of PCR product:  433
Brief description:  Choroideremia (CHM) is an X-linked,recessive, degenerative disorder of the choroid and retina of the human eye. The known defect in most CHM cases is in rep-1, a gene for rab escort protein gene (a geranyl geranyl transferase). Rab escort proteins are members of the Rab GDP dissociation inhibitor family (GDI) and are involved in membrane trafficking
Report any problems that might have appeared and any solutions:  rep-1 has four splice variants, primers were designed to amplify from all four in order to silence all of them at once
View(0) or add comments