| Worm gene name: | rep-1 |
| Worm sequence name: | Y67D2.1 |
| Related human gene: | rep-1 |
| Associated human disease: | Choroideremia |
| People involved in this project: |
|
| Left primer sequence: | tagcaccgatttcagctgtg |
| Right primer sequence: | gtgaagcctcttccagttgc |
| Size of PCR product: | 433 |
| Brief description: | Choroideremia (CHM) is an X-linked,recessive, degenerative disorder of the choroid and retina of the human eye. The known defect in most CHM cases is in rep-1, a gene for rab escort protein gene (a geranyl geranyl transferase). Rab escort proteins are members of the Rab GDP dissociation inhibitor family (GDI) and are involved in membrane trafficking |
| Report any problems that might have appeared and any solutions: | rep-1 has four splice variants, primers were designed to amplify from all four in order to silence all of them at once |
