Home | Projects | Login or register:
Username:   Password:

Worm gene name:  RIC-3
Worm sequence name:  T14A8.1
Related human gene:  hric3
Associated human disease:  Epilepsy
People involved in this project: 
Left primer sequence:  cgaccaaaaagcacatcaga
Right primer sequence:  caaataagggttgggcacat
Size of PCR product:  575
Brief description:  Ric-3 encodes novel highly charged protein with two transmembrane domains and extensive coiled-coil domains; Ric-3 necessary for maturation and function at least four nicotinic acetylcholine receptors.
Report any problems that might have appeared and any solutions: 
View(0) or add comments