| Worm gene name: | RIC-3 |
| Worm sequence name: | T14A8.1 |
| Related human gene: | hric3 |
| Associated human disease: | Epilepsy |
| People involved in this project: |
|
| Left primer sequence: | cgaccaaaaagcacatcaga |
| Right primer sequence: | caaataagggttgggcacat |
| Size of PCR product: | 575 |
| Brief description: | Ric-3 encodes novel highly charged protein with two transmembrane domains and extensive coiled-coil domains; Ric-3 necessary for maturation and function at least four nicotinic acetylcholine receptors. |
| Report any problems that might have appeared and any solutions: | |
