Worm gene name: | C31E10.7 |
Worm sequence name: | C31E10.7 |
Related human gene: | CYB5A |
Associated human disease: | methemoglobinemia due to cytochrome b5 deficiency |
People involved in this project: |
|
Left primer sequence: | tgtcttttctgtcttgtattgcag |
Right primer sequence: | tgcagcgtttagtcaaaagtt |
Size of PCR product: | 1000 |
Brief description: | PCR has been done for the designed primers; no transformation has been done yet. |
Report any problems that might have appeared and any solutions: | |