Worm gene name:  C31E10.7
Worm sequence name:  C31E10.7
Related human gene:  CYB5A
Associated human disease:  methemoglobinemia due to cytochrome b5 deficiency
People involved in this project: 
Left primer sequence:  tgtcttttctgtcttgtattgcag
Right primer sequence:  tgcagcgtttagtcaaaagtt
Size of PCR product:  1000
Brief description:  PCR has been done for the designed primers; no transformation has been done yet.
Report any problems that might have appeared and any solutions: 
View(0) or add comments