| Worm gene name: | C31E10.7 |
| Worm sequence name: | C31E10.7 |
| Related human gene: | CYB5A |
| Associated human disease: | methemoglobinemia due to cytochrome b5 deficiency |
| People involved in this project: |
|
| Left primer sequence: | tgtcttttctgtcttgtattgcag |
| Right primer sequence: | tgcagcgtttagtcaaaagtt |
| Size of PCR product: | 1000 |
| Brief description: | PCR has been done for the designed primers; no transformation has been done yet. |
| Report any problems that might have appeared and any solutions: | |
