Home | Projects | Login or register:
Username:   Password:

Worm gene name:  emb-9
Worm sequence name:  K04H4.1
Related human gene:  Collagen, type II, Alpha -1
Associated human disease:  SPONDYLOEPIPHYSEAL DYSPLASIA CONGENITA
People involved in this project: 
Left primer sequence:  gacaatccggaagagatgga
Right primer sequence:  ggaagtcctggtgatcctga
Size of PCR product:  388
Brief description:  emb-9 encodes the alpha-1 chain of Type IV basement membrane collagen most closely equivalent to human COL4A1 (OMIM:120130) on the basis of biological function; EMB-9 forms heterotrimeric Type IV collagen with LET-2, the alpha-2-like chain, and is required for the assembly and/or secretion of LET-2; EMB-9 is essential for embryonic morphogenesis, particularly epidermal elongation, and for larval development; EMB-9 is expresed primarily by body wall muscles and some somatic cells of the gonad and is detected in nearly all basement membranes.
Report any problems that might have appeared and any solutions: 
View(0) or add comments