| Worm gene name: | emb-9 |
| Worm sequence name: | K04H4.1 |
| Related human gene: | Collagen, type II, Alpha -1 |
| Associated human disease: | SPONDYLOEPIPHYSEAL DYSPLASIA CONGENITA |
| People involved in this project: |
|
| Left primer sequence: | gacaatccggaagagatgga |
| Right primer sequence: | ggaagtcctggtgatcctga |
| Size of PCR product: | 388 |
| Brief description: | emb-9 encodes the alpha-1 chain of Type IV basement membrane collagen most closely equivalent to human COL4A1 (OMIM:120130) on the basis of biological function; EMB-9 forms heterotrimeric Type IV collagen with LET-2, the alpha-2-like chain, and is required for the assembly and/or secretion of LET-2; EMB-9 is essential for embryonic morphogenesis, particularly epidermal elongation, and for larval development; EMB-9 is expresed primarily by body wall muscles and some somatic cells of the gonad and is detected in nearly all basement membranes. |
| Report any problems that might have appeared and any solutions: | |
