Home | Projects | Login or register:
Username:   Password:

Worm gene name:  yop-1
Worm sequence name:  Y71F9B.3
Related human gene:  dp1l1
Associated human disease: 
People involved in this project: 
Left primer sequence:  ttatgggattcgtctacccg
Right primer sequence:  tatcggcgaaatttccaatc
Size of PCR product:  300
Brief description:  this gene is highly conserved from yeast to human and is associated with vesicular transport.
Report any problems that might have appeared and any solutions: 
View(0) or add comments