Worm gene name: | yop-1 |
Worm sequence name: | Y71F9B.3 |
Related human gene: | dp1l1 |
Associated human disease: | |
People involved in this project: |
|
Left primer sequence: | ttatgggattcgtctacccg |
Right primer sequence: | tatcggcgaaatttccaatc |
Size of PCR product: | 300 |
Brief description: | this gene is highly conserved from yeast to human and is associated with vesicular transport. |
Report any problems that might have appeared and any solutions: | |