| Worm gene name: | yop-1 |
| Worm sequence name: | Y71F9B.3 |
| Related human gene: | dp1l1 |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | ttatgggattcgtctacccg |
| Right primer sequence: | tatcggcgaaatttccaatc |
| Size of PCR product: | 300 |
| Brief description: | this gene is highly conserved from yeast to human and is associated with vesicular transport. |
| Report any problems that might have appeared and any solutions: | |
