Worm gene name: | ags-3 |
Worm sequence name: | F32A6.4 |
Related human gene: | pcp2 |
Associated human disease: | |
People involved in this project: |
|
Left primer sequence: | acaggaaggggaacgtcttt |
Right primer sequence: | ccacataaatcgtcgcaatg |
Size of PCR product: | 377 |
Brief description: | This gene is associated with neurons in the retina and cerebellum of vertebrates. |
Report any problems that might have appeared and any solutions: | |