Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ags-3
Worm sequence name:  F32A6.4
Related human gene:  pcp2
Associated human disease: 
People involved in this project: 
Left primer sequence:  acaggaaggggaacgtcttt
Right primer sequence:  ccacataaatcgtcgcaatg
Size of PCR product:  377
Brief description:  This gene is associated with neurons in the retina and cerebellum of vertebrates.
Report any problems that might have appeared and any solutions: 
View(0) or add comments