| Worm gene name: | ags-3 |
| Worm sequence name: | F32A6.4 |
| Related human gene: | pcp2 |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | acaggaaggggaacgtcttt |
| Right primer sequence: | ccacataaatcgtcgcaatg |
| Size of PCR product: | 377 |
| Brief description: | This gene is associated with neurons in the retina and cerebellum of vertebrates. |
| Report any problems that might have appeared and any solutions: | |
