Home | Projects | Login or register:
Username:   Password:

Worm gene name:  cmd-1
Worm sequence name:  T21H3.3
Related human gene:  calmodulin
Associated human disease: 
People involved in this project: 
Left primer sequence:  gcgaatcaccaacacctttt
Right primer sequence:  ggttttacaggttggaggca
Size of PCR product:  374
Brief description:  efficiency 41.24 primer ranking 2
to silence proteins that affect the activity of tyrosine hydroxylase TyrH. calmodulin-calcium kinase labels TyrH and activates it. the worm tyrosine hydroxylase does not have the same phosphorylation sites as the vertebrate enzyme, but it does have multiple phosphorylation sites.
Report any problems that might have appeared and any solutions: 
View(0) or add comments