| Worm gene name: | cmd-1 |
| Worm sequence name: | T21H3.3 |
| Related human gene: | calmodulin |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | gcgaatcaccaacacctttt |
| Right primer sequence: | ggttttacaggttggaggca |
| Size of PCR product: | 374 |
| Brief description: | efficiency 41.24 primer ranking 2
to silence proteins that affect the activity of tyrosine hydroxylase TyrH. calmodulin-calcium kinase labels TyrH and activates it. the worm tyrosine hydroxylase does not have the same phosphorylation sites as the vertebrate enzyme, but it does have multiple phosphorylation sites. |
| Report any problems that might have appeared and any solutions: | |
