Home | Projects | Login or register:
Username:   Password:

Worm gene name:  C06H2.3
Worm sequence name:  WBGene00007387
Related human gene:  HIF-1a (603348)
Associated human disease:  Low O2 tolerance
People involved in this project: 
Left primer sequence:  cctcaagaaccaatcggaaa
Right primer sequence:  agccctttatcggcaatttt
Size of PCR product:  423
Brief description:  Interested in HIF (Hypoxia Induced Factor)-1 in humans that has been associated with Diebetes and other human diseases. It is a transcription factor that is induced under low O2 levels. Upon searching, I located a sequence I wanted to test.
Report any problems that might have appeared and any solutions: 
View(0) or add comments