| Worm gene name: | C06H2.3 |
| Worm sequence name: | WBGene00007387 |
| Related human gene: | HIF-1a (603348) |
| Associated human disease: | Low O2 tolerance |
| People involved in this project: |
|
| Left primer sequence: | cctcaagaaccaatcggaaa |
| Right primer sequence: | agccctttatcggcaatttt |
| Size of PCR product: | 423 |
| Brief description: | Interested in HIF (Hypoxia Induced Factor)-1 in humans that has been associated with Diebetes and other human diseases. It is a transcription factor that is induced under low O2 levels. Upon searching, I located a sequence I wanted to test. |
| Report any problems that might have appeared and any solutions: | |
