Home | Projects | Login or register:
Username:   Password:

Worm gene name:  fcd-2
Worm sequence name:  Y41E3.9
Related human gene:  Fanconi anemia complementation group D2 isoform b (homo sapiens)
Associated human disease:  Fanconi Anemia
People involved in this project: 
Left primer sequence:  caggagcatcttgttcgtga
Right primer sequence:  tcctcttctctccaacgcat
Size of PCR product:  338
Brief description:  cd-2 encodes an ortholog of the human gene FANCD2 (mutated in Fanconi anemia, OMIM:227646) that is strongly required for resistance to DNA interstrand crosslinking (ICL) agents, but not to ionizing radiation (IR); fcd-2 mutants are viable and dispensable for resistance to IR, meiotic recombination, and S-phase checkpoint activation, but are hypersensitive to ICL agents; like its human ortholog, FCD-2 is monoubiquitylated and recruited to chromosomal foci after ICL but not IR; transgenic expresssion of the FANCD2 gene in mutant FA-D2 cells rescues their abnormal sensitivity to mitomycin C, an agent that cross-links strands of DNA
Report any problems that might have appeared and any solutions: 
View(0) or add comments