| Worm gene name: |
fcd-2
|
| Worm sequence name: |
Y41E3.9
|
| Related human gene: |
Fanconi anemia complementation group D2 isoform b (homo sapiens)
|
| Associated human disease: |
Fanconi Anemia
|
| People involved in this project: |
|
| Left primer sequence: |
caggagcatcttgttcgtga
|
| Right primer sequence: |
tcctcttctctccaacgcat
|
| Size of PCR product: |
338
|
| Brief description: |
cd-2 encodes an ortholog of the human gene FANCD2 (mutated in Fanconi anemia, OMIM:227646) that is strongly required for resistance to DNA interstrand crosslinking (ICL) agents, but not to ionizing radiation (IR); fcd-2 mutants are viable and dispensable for resistance to IR, meiotic recombination, and S-phase checkpoint activation, but are hypersensitive to ICL agents; like its human ortholog, FCD-2 is monoubiquitylated and recruited to chromosomal foci after ICL but not IR; transgenic expresssion of the FANCD2 gene in mutant FA-D2 cells rescues their abnormal sensitivity to mitomycin C, an agent that cross-links strands of DNA
|
| Report any problems that might have appeared and any solutions: |
|