| Worm gene name: | fcd-2 |
| Worm sequence name: | Y41E3.9 |
| Related human gene: | Fanconi anemia complementation group D2 isoform b (homo sapiens) |
| Associated human disease: | Fanconi Anemia |
| People involved in this project: |
|
| Left primer sequence: | caggagcatcttgttcgtga |
| Right primer sequence: | tcctcttctctccaacgcat |
| Size of PCR product: | 338 |
| Brief description: | cd-2 encodes an ortholog of the human gene FANCD2 (mutated in Fanconi anemia, OMIM:227646) that is strongly required for resistance to DNA interstrand crosslinking (ICL) agents, but not to ionizing radiation (IR); fcd-2 mutants are viable and dispensable for resistance to IR, meiotic recombination, and S-phase checkpoint activation, but are hypersensitive to ICL agents; like its human ortholog, FCD-2 is monoubiquitylated and recruited to chromosomal foci after ICL but not IR; transgenic expresssion of the FANCD2 gene in mutant FA-D2 cells rescues their abnormal sensitivity to mitomycin C, an agent that cross-links strands of DNA |
| Report any problems that might have appeared and any solutions: | |
