Home | Projects | Login or register:
Username:   Password:

Worm gene name:  GFP within the GFP-marked C. elegans strain AZ235
Worm sequence name:  None
Related human gene:  None
Associated human disease: 
People involved in this project: 
Left primer sequence:  catggccaacacttgtcact
Right primer sequence:  tggtctctcttttcgttggg
Size of PCR product:  483
Brief description:  The project aims at silencing GFP expression in AZ235 using RNAi for visual assessment under UV microscope.
Report any problems that might have appeared and any solutions: 
View(0) or add comments