| Worm gene name: | GFP within the GFP-marked C. elegans strain AZ235 |
| Worm sequence name: | None |
| Related human gene: | None |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | catggccaacacttgtcact |
| Right primer sequence: | tggtctctcttttcgttggg |
| Size of PCR product: | 483 |
| Brief description: | The project aims at silencing GFP expression in AZ235 using RNAi for visual assessment under UV microscope. |
| Report any problems that might have appeared and any solutions: | |
