Worm gene name: | FRM-1 |
Worm sequence name: | ZK270.2 |
Related human gene: | TERT |
Associated human disease: | death |
People involved in this project: |
|
Left primer sequence: | ctcacccaagcagactgtga |
Right primer sequence: | gaacacgagcaatcagacga |
Size of PCR product: | 374 |
Brief description: | erythrocyte membrane protein. Ortholog to hTERT gene for telomerase catalization. |
Report any problems that might have appeared and any solutions: | |