Worm gene name:  FRM-1
Worm sequence name:  ZK270.2
Related human gene:  TERT
Associated human disease:  death
People involved in this project: 
Left primer sequence:  ctcacccaagcagactgtga
Right primer sequence:  gaacacgagcaatcagacga
Size of PCR product:  374
Brief description:  erythrocyte membrane protein. Ortholog to hTERT gene for telomerase catalization.
Report any problems that might have appeared and any solutions: