Home | Projects | Login or register:
Username:   Password:

Worm gene name:  K10D6.4
Worm sequence name:  K10D6.4
Related human gene:  none
Associated human disease:  none
People involved in this project: 
  • Ray Hong, California State University, Northridge, CA
Left primer sequence:  caacaccagaagacgctgaa
Right primer sequence:  gggacgttcaaaagaaacga
Size of PCR product:  341
Brief description:  This gene has no homologs outside of nematodes and encodes for proteins with unknown function. There is no reported RNAi or mutant phenotype
Report any problems that might have appeared and any solutions:  A 500 bp dsRNAi feeding vector didn't induce any mutant phenotype
View(0) or add comments