| Worm gene name: | K10D6.4 |
| Worm sequence name: | K10D6.4 |
| Related human gene: | none |
| Associated human disease: | none |
| People involved in this project: |
|
| Left primer sequence: | caacaccagaagacgctgaa |
| Right primer sequence: | gggacgttcaaaagaaacga |
| Size of PCR product: | 341 |
| Brief description: | This gene has no homologs outside of nematodes and encodes for proteins with unknown function. There is no reported RNAi or mutant phenotype |
| Report any problems that might have appeared and any solutions: | A 500 bp dsRNAi feeding vector didn't induce any mutant phenotype |
